Introduction to Biotechnology

Biotechnology is the use of living systems and organisms to develop or manufacture products, or any technological application that uses biological systems, living organisms, or their derivatives, to manufacture or modify products or processes for specific uses.

Biotechnology Applications in Cancer

Gene Therapy

Introduction of genes into an individual's cells to treat disease:

• Suicide Genes: Genes that kill tumor cells
• Immunotherapy: Stimulation of the immune system
• Viral Vectors: Transport of genetic material

Monoclonal Antibodies

Laboratory-made proteins that bind to specific targets:

• Labeling: Identification of cancer cells
• Blocking: Inhibition of growth signals
• Targeted Therapy: Specific attack on tumors

Molecular Diagnosis

Use of molecular biology techniques to identify cancer biomarkers:

• Early Diagnosis: Detection before symptoms
• Prognosis: Prediction of disease progression
• Treatment Selection: Personalized therapy

Tissue Engineering

Creation of tissues and organs in the laboratory:

• Tumor Models: Testing of new drugs
• Regenerative Therapies: Repair of damaged tissues
• Research: Study of cancer mechanisms

Computational Applications

Sequence Analysis

Install Biopython once in your environment:

pip install biopython

# NOTE: Educational example only; not a validated therapy-selection pipeline.
from Bio import SeqIO
from Bio.Align import PairwiseAligner

REFERENCE_SEQUENCE = "ATGCGATCGATCGATCGATCG"

def analyze_gene_sequence(sequence_file, reference_sequence=REFERENCE_SEQUENCE):
    """Align a FASTA gene sequence against a short reference sequence."""
    record = SeqIO.read(sequence_file, "fasta")
    query_sequence = str(record.seq).upper()

    aligner = PairwiseAligner()
    aligner.mode = "global"
    aligner.match_score = 2
    aligner.mismatch_score = -1
    aligner.open_gap_score = -0.5
    aligner.extend_gap_score = -0.1

    alignment = next(iter(aligner.align(query_sequence, reference_sequence)))
    return {
        "record_id": record.id,
        "score": alignment.score,
        "alignment": alignment,
    }

# Usage example
results = analyze_gene_sequence("gene.fasta")
print(f"Record: {results['record_id']}")
print(f"Alignment score: {results['score']:.1f}")
print(results["alignment"])

Biotechnological Techniques

• CRISPR/Cas9: Precise genome editing
• Real-time PCR: Gene expression quantification
• Next-generation Sequencing: Complete genomic analysis
• Microarrays: Large-scale gene expression analysis

Learning Resources

• Books: OpenStax Biology 2e: Biotechnology and Genomics
• Courses: MIT OpenCourseWare: Biological Engineering, edX biotechnology courses
• Tools: NCBI, Ensembl, GeneCards

---

Biotechnology plays a crucial role in developing new therapies and diagnostics for cancer.